Basic information from miRBase |
hairpin accession number: MI0015640 |
Located between position 4877813 and 4877867 on chromosome 5q strand - |
mature miRNAs for MI0015640: |
cin-miR-4087-5p (MIMAT0016662): TCATTTCCTCACCAATTATGT |
cin-miR-4087-3p (MIMAT0016663): ACGTGGATGTGGACTTGATA |
You can find this miRNA in ENTREZGENE: mir4087 (accession: 100499117) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |