miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015640
Located between position 4877813 and 4877867 on chromosome 5q strand -
mature miRNAs for MI0015640:
         cin-miR-4087-5p (MIMAT0016662): TCATTTCCTCACCAATTATGT
         cin-miR-4087-3p (MIMAT0016663): ACGTGGATGTGGACTTGATA
You can find this miRNA in ENTREZGENE: mir4087 (accession: 100499117)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"