| Basic information from miRBase |
| hairpin accession number: MI0015642 |
| Located between position 5364509 and 5364572 on chromosome 1q strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSCINT00000023503) |
| mature miRNAs for MI0015642: |
| cin-miR-4089-5p (MIMAT0016666): CTTGGAAATGCATGTGCTTT |
| You can find this miRNA in ENTREZGENE: mir4089 (accession: 100498945) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |