| Basic information from miRBase |
| hairpin accession number: MI0015644 |
| Located between position 2150745 and 2150829 on chromosome 10q strand - |
| mature miRNAs for MI0015644: |
| cin-miR-4091-5p (MIMAT0016668): TGGCAGTGAGCTATCGTAGC |
| cin-miR-4091-3p (MIMAT0016669): CAGCTGTTACCTCACTACCT |
| You can find this miRNA in ENTREZGENE: mir4091 (accession: 100499037) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |