| Basic information from miRBase |
| hairpin accession number: MI0015645 |
| Located between position 181157 and 181209 on chromosome 4q strand + |
| mature miRNAs for MI0015645: |
| cin-miR-4092-5p (MIMAT0016670): CGTGTTGTGGAGAACGACAA |
| cin-miR-4092-3p (MIMAT0016671): TAGGTCTGTCTACACAGCAA |
| You can find this miRNA in ENTREZGENE: mir4092 (accession: 100499069) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |