| Basic information from miRBase |
| hairpin accession number: MI0015772 |
| Located between position 1690856 and 1690905 on chromosome 8q strand - |
| Overlapping with sense strand of Q4H3M3_CIOIN (intron 2). |
| (Ensemble: ENSCINT00000013813) |
| mature miRNAs for MI0015772: |
| cin-miR-4215-3p (MIMAT0016836): TTAATGTATTATATGATTGT |
| You can find this miRNA in ENTREZGENE: mir4215 (accession: 100499143) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |