| Basic information from miRBase |
| hairpin accession number: MI0015773 |
| Located between position 6528008 and 6528093 on chromosome 2q strand + |
| mature miRNAs for MI0015773: |
| cin-miR-4216-5p (MIMAT0016837): AAGCTCTTCCTCAAAATTT |
| cin-miR-4216-3p (MIMAT0016838): TAAATTTGGTAGAAGAGCTT |
| You can find this miRNA in ENTREZGENE: mir4216 (accession: 100499015) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |