| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007155 |
| Located between position 1774516 and 1774593 on chromosome 1p strand - |
| mature miRNAs for MI0007155: |
| cin-miR-7 (MIMAT0006091): TGGAAGACTAGTGATTTTGTTG |
| cin-miR-7* (MIMAT0015251): CAACAATCTATGGTCTCCTGC |
| You can find this miRNA in ENTREZGENE: mir7 (accession: 100187667) |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| [2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
| more data |
| Data from CoGemiR |