| Basic information from miRBase |
| hairpin accession number: MI0015482 |
| Located between position 5965526 and 5965579 on chromosome 5q strand - |
| mature miRNAs for MI0015482: |
| cin-miR-9-5p (MIMAT0016396): TCTTTGGTTATCCAGTTTGA |
| You can find this miRNA in ENTREZGENE: mir9 (accession: 100499018) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |