| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007162 |
| Located between position 1865219 and 1865319 on chromosome 3p strand + |
| mature miRNAs for MI0007162: |
| cin-miR-92c* (MIMAT0015255): AGGCCTGGCGAAGTGCATTG |
| cin-miR-92c (MIMAT0006098): TATTGCACTCGTCCCGGTCTAT |
| You can find this miRNA in ENTREZGENE: mir92c (accession: 100187681) |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| [2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
| more data |
| Data from CoGemiR |