| Basic information from miRBase |
| hairpin accession number: MI0015495 |
| Located between position 2635396 and 2635447 on chromosome 1p strand - |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSCINT00000009080) |
| mature miRNAs for MI0015495: |
| cin-miR-92e-5p (MIMAT0016421): CGGTGTGGGTGGGTGCATGA |
| cin-miR-92e-3p (MIMAT0016422): TATTGCACTTCCCTAGACTG |
| You can find this miRNA in ENTREZGENE: mir92e (accession: 100498868) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |