miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006233
Located between position 233228 and 233363 on chromosome scaffold_76 strand +
mature miRNAs for MI0006233:
         cre-miR1172.2 (MIMAT0005432): TAGGATCGGAGACGCAGTGAA
         cre-miR1172.1 (MIMAT0005433): AGGATTGCAGCAGCAACGGGGC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"