| Basic information from miRBase |
| hairpin accession number: MI0005705 |
| Located between position 929764 and 930115 on chromosome scaffold_35 strand - |
| mature miRNAs for MI0005705: |
| cre-miR912 (MIMAT0004395): TGGATTGATCCCAGCCAGGC |
| References |
| [1]Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y, Genes Dev. 21:1190-1203(2007)., "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" |
| [2]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" |