miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005709
Located between position 1014120 and 1014384 on chromosome scaffold_6 strand -
mature miRNAs for MI0005709:
         cre-miR919.2 (MIMAT0004399): TCTCAGGAGGACATCGCCACT
         cre-miR919.1 (MIMAT0004969): AATCGAGATGCTGACCGAGAT

References
[1]Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y, Genes Dev. 21:1190-1203(2007)., "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii"
[2]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"