miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006212
Located between position 1934033 and 1934142 on chromosome scaffold_10 strand +
mature miRNAs for MI0006212:
         cre-miR1151a (MIMAT0005393): TCCGGGGCTCATAACCTGTTG
         cre-miR1151a* (MIMAT0005394): ACGGGGTGTGGGACCCGG

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"