miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006213
Located between position 1935781 and 1935924 on chromosome scaffold_10 strand +
mature miRNAs for MI0006213:
         cre-miR1151b (MIMAT0005395): TCCGGGGCTCATAACCTGTTA
         cre-miR1151b* (MIMAT0005396): ACGGGTTGTGGGACCCGGAC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"