miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006216
Located between position 1918568 and 1918688 on chromosome scaffold_15 strand -
mature miRNAs for MI0006216:
         cre-miR1154 (MIMAT0005402): ACTTAGTCATCCCAAGGCGT
         cre-miR1154* (MIMAT0005403): CGCCTTGTGACGACTAAGT

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"