miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006217
Located between position 2058507 and 2058606 on chromosome scaffold_15 strand +
mature miRNAs for MI0006217:
         cre-miR1155 (MIMAT0005404): TAGTCCTGCACGAGGAAGGAGC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"