miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006219
Located between position 251268 and 251404 on chromosome scaffold_18 strand +
mature miRNAs for MI0006219:
         cre-miR1157* (MIMAT0005407): ACCTGGTCCCGCTATTTGAATC
         cre-miR1157 (MIMAT0005408): TTCAGGTAGCGGGACCAGGTG

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"