miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006223
Located between position 167785 and 167927 on chromosome scaffold_3 strand -
mature miRNAs for MI0006223:
         cre-miR1162* (MIMAT0005415): CGGCCTAAATTACTACAACACG
         cre-miR1162 (MIMAT0005416): TGTTGTAGTAGTTTAGCCCTGC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"