miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006234
Located between position 2068926 and 2069014 on chromosome scaffold_10 strand -
mature miRNAs for MI0006234:
         cre-miR1167 (MIMAT0005434): GGGGTGTGATGATTTGAAAC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"