miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011068
Located between position 2006530 and 2006623 on chromosome Crem_Contig0 strand -
mature miRNAs for MI0011068:
         crm-miR-230* (MIMAT0011547): ACTTGGTCGACAATCTAATATT
         crm-miR-230 (MIMAT0011548): GTATTAGTTGTGCGACCAGGAG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"