miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011073
Located between position 747854 and 747962 on chromosome Crem_Contig4 strand +
mature miRNAs for MI0011073:
         crm-miR-235* (MIMAT0011557): AGGCCTTGGCCGAATGCATATATT
         crm-miR-235 (MIMAT0011558): TATTGCACTCGCCCCGGCCTG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"