miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011061
Located between position 438956 and 439060 on chromosome Crem_Contig31 strand +
mature miRNAs for MI0011061:
         crm-miR-47 (MIMAT0011542): TGTCATGGAGGCGCTCTCTTC

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"