miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011069
Located between position 55 and 147 on chromosome Crem_Contig1341 strand +
mature miRNAs for MI0011069:
         crm-miR-52 (MIMAT0011549): CACCCGTACATATGTTTCCGTGCT
         crm-miR-52* (MIMAT0011550): CACGTTACAATATATGGGTCG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"