miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011116
Located between position 453664 and 453781 on chromosome Crem_Contig50 strand +
mature miRNAs for MI0011116:
         crm-miR-63 (MIMAT0011622): TCTAACTCGTCGGTAGTCATTGTT
         crm-miR-63* (MIMAT0011623): TATGACACTGAAGCGAGTTAG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"