miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011126
Located between position 72225 and 72316 on chromosome Crem_Contig41 strand +
mature miRNAs for MI0011126:
         crm-miR-64b (MIMAT0011637): CATGACACTCAAGCATACCATGG
         crm-miR-64b* (MIMAT0011638): CATGTATGGTTAGTGTTATCAT

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"