miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011078
Located between position 152301 and 152413 on chromosome Crem_Contig94 strand -
mature miRNAs for MI0011078:
         crm-miR-72 (MIMAT0011567): AGGCAAGATGTTGGCATAGCTG
         crm-miR-72* (MIMAT0011568): AGCTCGGCCACATACTGCCACG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"