miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011040
Located between position 15995 and 16114 on chromosome Crem_Contig233 strand -
mature miRNAs for MI0011040:
         crm-miR-74a (MIMAT0011522): TGGCAAGAAATGGCAGTCCAG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"