miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011079
Located between position 1757270 and 1757363 on chromosome Crem_Contig15 strand -
mature miRNAs for MI0011079:
         crm-miR-81* (MIMAT0011569): CGGTTTTCACCTTGATCTGAG
         crm-miR-81 (MIMAT0011570): TGAGATCATCGTGAAAGCTAGT

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"