miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011074
Located between position 340217 and 340324 on chromosome Crem_Contig45 strand +
mature miRNAs for MI0011074:
         crm-miR-84 (MIMAT0011559): TGAGGTAGTTTGTAATGCTGTCG
         crm-miR-84* (MIMAT0011560): ACATCATTTCAACTGCCTCGGC

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"