| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007196 |
| Located between position 31866 and 31949 on chromosome reftig_613 strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSCSAVT00000000099) |
| mature miRNAs for MI0007196: |
| csa-miR-141 (MIMAT0006129): TAACACTGTCTGGTAAAGATGC |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| more data |
| Data from CoGemiR |