| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007132 |
| Located between position 1053106 and 1053208 on chromosome reftig_55 strand - |
| Overlapping with sense strand of (intron 8). |
| (Ensemble: ENSCSAVT00000002466) |
| mature miRNAs for MI0007132: |
| csa-miR-1497 (MIMAT0006070): TTGAAGAATTGCAGGTGGTAGGT |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| more data |
| Data from CoGemiR |