| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007202 |
| Located between position 3924783 and 3924863 on chromosome reftig_16 strand + |
| Overlapping with sense strand of (intron 8). |
| (Ensemble: ENSCSAVT00000019714) |
| mature miRNAs for MI0007202: |
| csa-miR-216b (MIMAT0006135): TAATCTCTGCAGGCAACTGTGA |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| more data |
| Data from CoGemiR |