Basic information from miRBase |
hairpin accession number: MI0007186 |
Located between position 3091327 and 3091429 on chromosome reftig_30 strand + |
Overlapping with sense strand of (intron 4). |
(Ensemble: ENSCSAVT00000017540) |
mature miRNAs for MI0007186: |
csa-miR-7 (MIMAT0006120): TGGAAGACTAGTGATTTTGTTGT |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
more data |
Data from CoGemiR |