miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000116
Located between position 20487441 and 20487531 on chromosome 2L strand +
mature miRNAs for MI0000116:
         dme-miR-1-5p (MIMAT0020779): CCATGCTTCCTTGCATTCAATA
         dme-miR-1-3p (MIMAT0000105): TGGAATGTAAAGAAGTATGGAG
You can find this miRNA in EMBL: (accession: AJ421756)

References
[1]Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[2]Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"
[3]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[4]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[5]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"


more data
Data from CoGemiR