| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005849 |
| Located between position 11952759 and 11952849 on chromosome 2R strand - |
| mature miRNAs for MI0005849: |
| dme-miR-137-5p (MIMAT0020888): ACGTGTATGCTCGTAGCTATAAC |
| dme-miR-137-3p (MIMAT0005507): TATTGCTTGAGAATACACGTAG |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| [2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" |
| more data |
| Data from CoGemiR |