miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000343

Located between position 11953410 and 11953503 on chromosome 2L strand -

mature miRNAs for MI0000343:

dme-miR-263a-5p (MIMAT0000319): GTTAATGGCACTGGAAGAATTCAC

dme-miR-263a-3p (MIMAT0020799): CGTGATCTCTTAGTGGCATCTA

You can find this miRNA in TARGETS:MIRTE: miR-263a (accession: miR-263a)

References

[1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs"

[2]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"

[3]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[4]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"

more data

Data from CoGemiR