| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000365 |
| Located between position 4185611 and 4185705 on chromosome 2R strand + |
| mature miRNAs for MI0000365: |
| dme-miR-280-5p (MIMAT0000343): TGTATTTACGTTGCATATGAAATGATA |
| You can find this miRNA in TARGETS:MIRTE: miR-280 (accession: miR-280) |
| References |
| [1]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes" |
| more data |
| Data from CoGemiR |