| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000384 |
| Located between position 20618366 and 20618462 on chromosome 2L strand - |
| mature miRNAs for MI0000384: |
| dme-miR-288-3p (MIMAT0000363): TTTCATGTCGATTTCATTTCATG |
| You can find this miRNA in TARGETS:MIRTE: miR-288 (accession: miR-288) |
| References |
| [1]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes" |
| more data |
| Data from CoGemiR |