miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000419
Located between position 10103307 and 10103369 on chromosome 2R strand -
Overlapping with sense strand of RpS23-RA (intron 2).
(Ensemble: FBtr0087575) (FlyBase: FlyBase)
mature miRNAs for MI0000419:
         dme-miR-308-5p (MIMAT0020833): CGCAGTATATTTTTGTGTTTTG
         dme-miR-308-3p (MIMAT0000399): AATCACAGGATTATACTGTGAG
You can find this miRNA in TARGETS:MIRTE: miR-308 (accession: miR-308)

References
[1]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[2]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[3]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"


more data
Data from CoGemiR