miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005807
Located between position 3299055 and 3299151 on chromosome 3L strand +
mature miRNAs for MI0005807:
         dme-miR-955-5p (MIMAT0005466): CATCGTGCAGAGGTTTGAGTGTC
         dme-miR-955-3p (MIMAT0020847): CATTCAATTTCTGAACGGTAGA

References
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"


more data
Data from CoGemiR