miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005810
Located between position 11766831 and 11766978 on chromosome 3L strand -
mature miRNAs for MI0005810:
         dme-miR-956-5p (MIMAT0020850): GTGTTTGGAATGGTCTCGTTAGCT
         dme-miR-956-3p (MIMAT0005469): TTTCGAGACCACTCTAATCCATT

References
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"


more data
Data from CoGemiR