miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000415
Located between position 16698744 and 16698834 on chromosome 2L strand +
Overlapping with sense strand of grp-RC (intron 7).
(Ensemble: FBtr0080885) (FlyBase: FlyBase)
mature miRNAs for MI0000415:
         dme-miR-9b-5p (MIMAT0000395): TCTTTGGTGATTTTAGCTGTATG
         dme-miR-9b-3p (MIMAT0020829): TAGAGCTTTATTACCAAAAACC
You can find this miRNA in TARGETS:MIRTE: miR-9b (accession: miR-9b)

References
[1]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[2]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"
[3]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"


more data
Data from CoGemiR