miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005805
Located between position 12681997 and 12682064 on chromosome 3R strand -
Overlapping with antisense strand of iab-4-RA (exon 3).
(Ensemble: FBtr0083362) (FlyBase: FlyBase)
mature miRNAs for MI0005805:
         dme-miR-iab-8-5p (MIMAT0005463): TTACGTATACTGAAGGTATACCG
         dme-miR-iab-8-3p (MIMAT0005464): GGATACATTCAGTATACGTTTA

References
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[2]Stark A, Bushati N, Jan CH, Kheradpour P, Hodges E, Brennecke J, Bartel DP, Cohen SM, Kellis M, Genes Dev. 22:8-13(2008)., "A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands"