| Basic information from miRBase |
| hairpin accession number: MI0001858 |
| Located between position 20399518 and 20399601 on chromosome 15 strand + |
| mature miRNAs for MI0001858: |
| dre-let-7a (MIMAT0001759): TGAGGTAGTAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: mirlet7a-2 (accession: 100033534) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |