| Basic information from miRBase |
| hairpin accession number: MI0001866 |
| Located between position 29144917 and 29145023 on chromosome 15 strand + |
| Overlapping with sense strand of zgc:153372-201 (intron 10). |
| (Ensemble: ENSDART00000099958) |
| mature miRNAs for MI0001866: |
| dre-let-7c (MIMAT0001761): TGAGGTAGTAGGTTGTATGGTT |
| You can find this miRNA in ENTREZGENE: mirlet7c-1 (accession: 100033540) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |