| Basic information from miRBase |
| hairpin accession number: MI0001871 |
| Located between position 5478692 and 5478791 on chromosome 23 strand - |
| mature miRNAs for MI0001871: |
| dre-let-7e (MIMAT0001763): TGAGGTAGTAGATTGAATAGTT |
| You can find this miRNA in ENTREZGENE: mirlet7e (accession: 100033544) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |