| Basic information from miRBase |
| hairpin accession number: MI0001873 |
| Located between position 18553174 and 18553269 on chromosome 23 strand - |
| Overlapping with sense strand of fam120c-201 (3UTR 17). |
| (Ensemble: ENSDART00000065881) |
| mature miRNAs for MI0001873: |
| dre-let-7g (MIMAT0001765): TGAGGTAGTAGTTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: mirlet7g-1 (accession: 100033546) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |