| Basic information from miRBase |
| hairpin accession number: MI0001874 |
| Located between position 28779253 and 28779349 on chromosome 23 strand + |
| Overlapping with sense strand of huwe1-001 (intron 56). |
| (Ensemble: OTTDART00000038190) |
| mature miRNAs for MI0001874: |
| dre-let-7g (MIMAT0001765): TGAGGTAGTAGTTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: mirlet7g-2 (accession: 100033547) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |