miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003343
Located between position 41385655 and 41385737 on chromosome 6 strand +
Overlapping with sense strand of wdr82-001 (intron 2).
(Ensemble: OTTDART00000024645)
mature miRNAs for MI0003343:
         dre-let-7j (MIMAT0003015): TGAGGTAGTTGTTTGTACAGTT
You can find this miRNA in ENTREZGENE: mirlet7j (accession: 100033723)

References
None